Figure 4
From: "Color Timer" mice: visualization of neuronal differentiation with fluorescent proteins

KOr fluorescence in the two neurogenic regions in the brains of adult nestin/KOr mice. Animals were genotyped at P2w by polymerase chain reaction (PCR) with the primer pair "hKO-Int.F" (TGAAGTACTTCATGGACGGC) and "hKO-Int.R" (TGAACTGGCACTTGTGGTTG). The resultant product was ~500 bp. (A) Fixed brains of P8w nestin/KOr Tg mice were cut into 40-μm sections with a Vibratome (Leica) and fluorescent micrography was performed with an ApoTome fluorescence microscope and the AxioVision software (Zeiss). (B) Comparison of the KOr fluorescence and the distribution of the Nestin protein around the lateral ventricle (LV; top panels) and at the dorsolateral corner (DLC; bottom panels). The slices were prepared essentially as in (A), and immunohistochemistry was performed as described in Figure 2. Scale bar: 200 μm (top row) and 100 μm (bottom row).