Figure 5From: "Color Timer" mice: visualization of neuronal differentiation with fluorescent proteinsTransition from orange to green fluorescence in RMS of adult nestin/KOr - DCX-EGFP double Tg. Animals were genotyped at P2w by PCR with the KOr-specific primer pair (above) and a GFP-specific primer pair "GFP-Int.F3" (GCACGACTTCTTCAAGTCCGCCATGCC) and "GFP-Int.R3" (GCGGATCTTGAAGTTCACCTTGATGCC). The size of the PCR product for GFP was 265 bp. Nestin IHC was performed with the same primary Ab as in Figure 2 and an Alexa 350-conjugated anti-mouse secondary Ab (Jackson ImmunoResearch; 1:250). Scale bar: 100 μm.Back to article page