Skip to main content

Table 2 Details of the bisulfite-pyrosequencing DNA methylation assays utilized in this study

From: DNA methylation at the Igf2/H19 imprinting control region is associated with cerebellum mass in outbred mice

Regions Position PCR primers (5′ to 3′) Annealing temperature (°C) Cycle number Product length (bp) Sequencing primers (5′ to 3′) CpGs Coordinates in NCBI37/mm9
CTCF binding site 1 F TTGTTGAATTAGTTGTGGGGTTTA 56 46 149 GAATTAGTTGTGGGGTTTATA 6 chr7:149,767,865-149,768,017
R Biotin-ATTCCAATACCAAAAATAAAAAAACTCT   
CTCF binding site 2 F Biotin-AAAGAATTTTTTGTGTGTAAAGATT 56 46 168 AACTCAATCAATTACAATCC 6 chr7:149,767,573-149,767,748
R ATCAAAAACTAACATAAACCCCTAAC   
CTCF binding site 3 F GGGTTTTTTTGGTTATTGAATTTTAA 56 46 224 TGTTATGTGTAATAAGGGAA 6 chr7:149,766,533-149,766,776
R Biotin-AATACACACATCTTACCACCCCTATA   
CTCF binding site 4 F Biotin-TTTTTGGGTAGTTTTTTTAGTTTTG 56 46 211 CTATAACCAAATCTACACAA 5 chr7:149,766,109-149,766,322
R ACACAAATACCTAATCCCTTTATTAAAC ACTCAAAACTTTATCACAAC 7
  1. Primers for CTCF binding site 1 were designed using PyroMark Assay Design software 2.0 (Qiagen, UK). Primer sequences for all other CTCF binding sites were obtained from a previously published study (Fauque P et al. Hum Mol Genet.[2010]).
\