DNA methylation at the Igf2/H19 imprinting control region is associated with cerebellum mass in outbred mice

Table 2 Details of the bisulfite-pyrosequencing DNA methylation assays utilized in this study

Regions	Position	PCR primers (5′ to 3′)	Annealing temperature (°C)	Cycle number	Product length (bp)	Sequencing primers (5′ to 3′)	CpGs	Coordinates in NCBI37/mm9
CTCF binding site 1	F	TTGTTGAATTAGTTGTGGGGTTTA	56	46	149	GAATTAGTTGTGGGGTTTATA	6	chr7:149,767,865-149,768,017
CTCF binding site 1	R	Biotin-ATTCCAATACCAAAAATAAAAAAACTCT	56	46	149			chr7:149,767,865-149,768,017
CTCF binding site 2	F	Biotin-AAAGAATTTTTTGTGTGTAAAGATT	56	46	168	AACTCAATCAATTACAATCC	6	chr7:149,767,573-149,767,748
CTCF binding site 2	R	ATCAAAAACTAACATAAACCCCTAAC	56	46	168			chr7:149,767,573-149,767,748
CTCF binding site 3	F	GGGTTTTTTTGGTTATTGAATTTTAA	56	46	224	TGTTATGTGTAATAAGGGAA	6	chr7:149,766,533-149,766,776
CTCF binding site 3	R	Biotin-AATACACACATCTTACCACCCCTATA	56	46	224			chr7:149,766,533-149,766,776
CTCF binding site 4	F	Biotin-TTTTTGGGTAGTTTTTTTAGTTTTG	56	46	211	CTATAACCAAATCTACACAA	5	chr7:149,766,109-149,766,322
CTCF binding site 4	R	ACACAAATACCTAATCCCTTTATTAAAC	56	46	211	ACTCAAAACTTTATCACAAC	7	chr7:149,766,109-149,766,322

Primers for CTCF binding site 1 were designed using PyroMark Assay Design software 2.0 (Qiagen, UK). Primer sequences for all other CTCF binding sites were obtained from a previously published study (Fauque P et al. Hum Mol Genet.[2010]).

ISSN: 1756-6606