Skip to main content

Table 1 Primer details for real-time PCR

From: A human Dravet syndrome model from patient induced pluripotent stem cells

Target Forward Reverse
β-actin GATCAAGATCATTGCTCCTCCT GGGTGTAACGCAACTAAGTCA
Sox2 (tg * ) ACGGCCATTAACGGCACACTG CCCTTTTTCTGGAGACTAAATAAA
Klf4 (tg) CACCTCGCCTTACACATGAAGAG  
Oct3/4 (tg) TCTGGGCTCTCCCATGCATTCAAAC  
c-Myc (tg) CTTGAACAGCTACGGAACTCTTG  
SCN1A AACAGAATCAGGCCACCTTG CACTGGGCTCTCTGGAATG
SCN2A GCTACACGAGCTTTGACACC CCCAAGAAAATGACCAGCAC
SCN3A ATGGTGTGGTTTCCTTGGTG TGACTTCCGTTTCTGTGGTG
SCN8A GGACCCATGGAACTGGTTAG ACCCTGAAAGTGCGTAGAGC
Nkx2.1 AGCACACGACTCCGTTCTCA CCCTCCATGCCCACTTTCTT
Parvalbumin CTGGACAAGGACAAAAGTGG ACAGGTCTCTGGCATCTGG
  1. All sequences are displayed in 5′-to-3′ direction. *tg, transgene.