Skip to main content

Table 3 Primer sequences for RT-PCR

From: Repair of astrocytes, blood vessels, and myelin in the injured brain: possible roles of blood monocytes

Gene Sequence (5′-3′)
TNF-α F: GTAGCCCACGTCGTAGCAAA
R: CCCTTCTCCAGCTGGGAGAC
iNOS F: GCAGAATGTGACCATCATGG
R: ACAACCTTGGTGTTGAAGGC
TGF-β F: GAGAGCCCTGGATACCAACTACTG
R: GTGTGTCCAGGCTCCAAATGTAG
MR F: GTAGTTCTATCTTCATCTTC
R: AATATAAGACAGTCACATTA
GAPDH F: TCCCTCAAGATTGTCAGCAA
R: AGATCCACAACGGATACATT
  1. F Forward primer, R Reverse primer.