Skip to main content

Table 1 List of primers used for quantitative real-time PCR analysis and for the 5ht4r cDNA probe

From: Role of the 5-HT4 receptor in chronic fluoxetine treatment-induced neurogenic activity and granule cell dematuration in the dentate gyrus

Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
Bdnf gacaaggcaacttggcctac actgtcacacacgctcagctc
Npy ccacgatgctaggtaaca ggaaaagtcgggagaac
5ht4r gatgctaatgtgagttccaacga gcagcagatggcgtaatacct
18S rRNA gaggccctgtaattggaatgag gcagcaactttaatatacgctattgg
5ht4r (for in situ probe) ggtcaacaagccctatgctatc taagtatcactgggctgag