Skip to main content

Table 1 Primers for quantitative real-time PCR

From: Fstl1 is involved in the regulation of radial glial scaffold development

  Forward Reverse
AKT1 CGGATACCATGAACGACGTAG GCAGGCAGCGGATGATAAAG
BMP7 GAAGTCCATCTCCGTAGTATCCG TCTGGTCACTGCTGCTGTTTT
Cdc42 GTTGGTGATGGTGCTGTTG CTGTGGATAACTTAGCGGTCG
Etv5 AAGAGGTTGCTCGCCGTTG CCTTCTGCATGATGCCCTTTT
Fstl1 GCTCCCACCTTCGCCTCTAA CCCTGCCAGCTCCACAAAA
GSK3b TTGTCTGCCGAAATGAGTTGA GTTTGCTTTGGGCTTGCTT
Itga5 GACCTGGGCTTAGAAACCTATT TGAGGTTCCAGGTCTGTTTG
Itga6 TGGCCTTCTTTCTCCATCTC CTGTCGACCCTGTGCTTTA
Itgb1 GACAGTGTGTGTGTAGGAAGAG GCCTCCACAAATTAAGCCATTAG
Reelin CCCAGCCCAGACAGACAGTT CCAGGTGATGCCATTGTTGA