Skip to main content

Advertisement

Table 1 Primers of the target genes used for real-time PCR

From: Mesenchymal stem cells suppress neuronal apoptosis and decrease IL-10 release via the TLR2/NFκB pathway in rats with hypoxic-ischemic brain damage

Primers Sequences
TLR2 F: TCTTGATGGCTGTGATAGG
  R: CCGAGGGAATAGAGGTGA
NFκB P65 F: AGGACTGCCGGGATGGCTTCTAT
  R: GGTCTGGATGCGCTGGCTAATGG
Bax F: AAGTAGAAGAGGGCAACCAC
  R: GATGGCAACTTCAACTGGG
GAPDH F: CCTGGAGAAACCTGCCAAG
  R: CACAGGAGACAACCTGGTCC