From: Expression of acid-sensing ion channels and selection of reference genes in mouse and naked mole rat
Gene | Accession no. | Primer fw | Primer rv | Sequence length (bp) |
---|---|---|---|---|
ASIC1a | NM_009597 | gaactgaagaccgaggaggag | gccgctcataggagaagatgt | 112 |
ASIC1b | NM_001289791 | tcagctaccctgacttgctcta | gagcggttgtagaaacgatgga | 139 |
ASIC2a | NM_001034013 | cgatggacctcaaggagagc | atacacgaagatgtggcggat | 107 |
ASIC2b | NM_007384 | cttgctgttgtcctggtcct | ttgttgttgcacacggtgac | 123 |
ASIC3 | NM_183000 | ttcacctgtcttggctcctc | tgactggggatgggatttctaag | 126 |
ASIC4 | NM_183022 | caccttgctggagatccttga | gtccgcagtggggtcttg | 150 |