Skip to main content

Table 2 Mouse qPCR primers

From: Expression of acid-sensing ion channels and selection of reference genes in mouse and naked mole rat

Gene Accession no. Primer fw Primer rv Sequence length (bp)
ASIC1a NM_009597 gaactgaagaccgaggaggag gccgctcataggagaagatgt 112
ASIC1b NM_001289791 tcagctaccctgacttgctcta gagcggttgtagaaacgatgga 139
ASIC2a NM_001034013 cgatggacctcaaggagagc atacacgaagatgtggcggat 107
ASIC2b NM_007384 cttgctgttgtcctggtcct ttgttgttgcacacggtgac 123
ASIC3 NM_183000 ttcacctgtcttggctcctc tgactggggatgggatttctaag 126
ASIC4 NM_183022 caccttgctggagatccttga gtccgcagtggggtcttg 150
  1. Forward (fw) and reverse (rv) primers in 5′-3′ orientation, accession number and length of product in base pairs