Skip to main content

Table 3 Naked mole-rat qPCR primers

From: Expression of acid-sensing ion channels and selection of reference genes in mouse and naked mole rat

Gene Accession no. Primer fw Primer rv Sequence length (bp)
ASIC1a XM_013078965.1 atgagataccagacacgcagat gcagcatgtctcgaatgtcatg 144
ASIC1b NM_001279840 ggtgccagtcatgtctttgtg catgcgggtagctgaggtaata 136
ASIC2a XM_013067767 gcacgttaccaaggtggatgag tggtggtgagcctggagaa 101
ASIC2b XM_004870614.2 tcgaaccgcctgctgtact gggttgttattgcacacggtga 107
ASIC3 00000022115 atccgagtgcagatccacag gttcctcaaagtcggagtccat 172
ASIC4 XM_004864511.1 ccagcaacttctctgtggtctat actcctcctgctggatgtcta 163
  1. Forward (fw) and reverse (rv) primers in 5′-3′ orientation, accession number and length of product in base pairs