Skip to main content

Advertisement

Table 1 The detailed information of primer sequence

From: Identification of lncRNA expression profiles and ceRNA analysis in the spinal cord of morphine-tolerant rats

Sequence name Primer sequence Amplicon size (bp)
GAPDH(RAT) F:5’ GCTCTCTGCTCCTCCCTGTTCTA3’
R:5’ TGGTAACCAGGCGTCCGATA3’
124
MRAK161211 F:5’CTGACCCCAAAGTTTCACATCT3’
R:5’CCAGGAGAGGTGTTCCAAGTAA3’
63
MRAK038897 F:5’TGGCAAGAATACCAAAGAGC3’
R:5’CACAGCAAGATGTAATGCACAG3’
132
MRAK014088 F:5’GTGTCTATTTCTGGGAGTCTGTGC3’
R:5’GCCATTGGTAAGAGAATTAAGCAG3’
102
MRAK080737 F:5’GTGCCAGACCCCAAGGTAAA3’
R:5’GAGACAATAATGGAGCCGCC3’
105
MRAK159688 F:5’GTACTGTAGCTCTTCAGCGTCC3’
R:5’GTCAGAACATTCAGACCACCTC3’
78
MRAK046606 F:5’GCCAGCATCTCCTACTCACA3’
R:5’TGGACTACGGACTACAGTTTACC3’
80
MRAK150340 F:5’ACAGAGTAGGGCAGTCGCAG3’
R:5’GGTTGTGGACCATAGAAGAGTTG3’
205
DQ266361 F:5’TGTGGTTAAATCCCCATGC3’
R:5’CTTCTCCAAGTCACATCTGCTC3’
63
XR_006440 F:5’GGAGCATCAAATCGAAAGC3’
R:5’ACTCGGATCGTCTCAAGGAC3’
162
XR_005988 F:5’TGTGACACCACTGAGACCCTT3’
R:5’TGGCCCTCCACACTTTACGA3’
101
uc.48+ F:5’ AAATGCAAACTGGATGAGGA 3′
R:5’ GTTAACACTGTATGTAATTAGGG 3’
279
uc.310- F:5’ CTAATCAAAAACTGACAGCAAGA 3′
R:5’ GATCTTTCTTAAGCAGAATTTGG 3’
128
XR_009527 F:5’ CCAAGGCCCGTATTGAGATTA 3′
R:5’ AGGGTCCAATGTGCCACGA 3’
116
XR_008662 F:5’ TAATGAGGAAGATGAGAATGGC 3′
R:5’ CCAGATAGGCTTCGTCTTATTC 3’
103
S66184 F:5’ TCTTCACATTACCATTACGAGGA 3′
R:5’ CATCGGAATGATTTTGCTGTGT 3’
51
AF196267 F:5’ GCCATCAATTTTCTCTTGACTG 3′
R:5’ TGAAGGGTCAGTTTGAAGCA 3’
135
MRAK077287 F:5’ GCTAATAATTCCTACCAGCAAA 3′
R:5’ ACCTCACACCCAGTCTCTACAT 3’
151
MRAK141001 F:5’ CTTCCCTACCAGTCTATTGAGTG 3′
R:5’ ACGCTCCACTACAAAATCAGTT 3’
87
S100a8 F:5’GGGAATCACCATGCCCTCTA3′
R:5’GCCCACCCTTATCACCAACA3’
168
Batf F:5’GAGGACCTGGAGAAACAGAATG3’
R:5’GCTCAGCACCGATGTGAAGTA3’
87
Ccl7 F:5’GCTGCTATGTCAAGAAACAAAAGA3’
R:5’TGATGGGCTTCAGCACAGACT3’
136
RT1-Bb F:5’GCCCTCAACCACCACAACTT3’
R:5’GGTCCAGTCCCCGTTCCTAAT3’
141
Prrx2 F:5’AAGAAGAAGCAGCGTCGGA3’
R:5’CAAAGGCGTCAGGGTAGTGT3’
97
Asb2 F:5’TGCTTTTCCTGCCTGTATGG3’
R:5’CGACAGGAACTCACAGAACTGC3’
120
RatNP-3b F:5’ CATACGCCAAAGTCTGAAACC 3′
R:5’ AGCAGTGCCTTTATCCCCTC 3’
168
Grm2 F:5’ CCCGGAGAACTTCAACGAA 3′
R:5’ GGCTGGAAAAGGATGATGTG 3’
207
Mmp9 F:5’ CCCACTTACTTTGGAAACG 3′
R:5’ GAAGATGAATGGAAATACGC 3’
228
Fam111a F:5’ GACTATTTCTCTCAGGTTCCCA 3′
R:5’ GTGCTGCATACAAGCTACTTGT 3’
256
Kcnv2 F:5’ GGGCTGCGGTAAGCATCTCT 3′
R:5’ TTGAGAATAATCCCAAAAGCGA 3’
106
Tmem119 F:5’ AGACAGTCGAACGGTCTAACAG 3′
R:5’ TCACAAGTAGCAGCAGAGACAG 3’
127