Skip to main content

Table 2 Primers used for gene expression analysis of genes associated with microglia activation

From: Absence of BBSome function leads to astrocyte reactivity in the brain

Genes Primers
Iba1 Forward: 5’gcagcacttgggtaacacct3’
Reverse: 5’taaccacccctcctttcctc
Cd68 Forward: 5’actggtgtagcctagctggt3’
Reverse: 5’ccttgggctataagcggtcc3’
Tlr3 Forward: 5’ccagaagaatctaatcaaattagatttgtc3’
Reverse: 5’ttttgctaagagcagttcttggag3’
Tlr4 Forward:5’ggcaacttggacctgaggag3’
Reverse:5’catgggctctcggtccatag3’
Gapdh Forward: 5’catttcctggtatgacaatgaatacg3’
Reverse:5’tccagggtttcttactccttgga3’
TMEM119 Forward:5’gcatgaagaaggcctggac3’
Reverse:5’ctgggtagcagccagaatgt3’