Skip to main content

Table 1 Sequences of primer pairs for qRT-PCR

From: Role of miR-326 in neonatal hypoxic-ischemic brain damage pathogenesis through targeting of the δ-opioid receptor

GeneForward primerReverse primer
has-miR-3265′-ACTGTCCTTCCCTCTGGGC-3″5′-AATGGTTGTTCTCCACTCTCTCTC-3’
has-DOR5′-CAAGATCTGCGTGTTCCT-3′5′-CGATGACGAAGATGTGGATG-3′
U65′-CTCGCTTCGGCAGCACA-3′5′-TGGTGTCGTGGAGTCG-3′
GAPDH5′-CATGAGAAGTATGACAACAGCCT-3′5′- AGTCCTTCCACGATACCAAAGT-3′
rat-miR-3265′- CGGGCCCTCTGGGCCCTTC-3′5′- TGGGTTCATTTCTGGGTCTT-3′
rat-DOR5′-CTGGGACACTGTGACCAAGAT-3’5′-GTCCAGACGATGACGAAGATG-3’
rat-Bcl-25′- GGCATCTTCTCCTTCCAG-3’5′- CATCCCAGCCTCCGTTAT-3’
rat-Bax5′- TTTGTTACAGGGTTTCATCCAGG-3’5′- TTCCAGATGGTGAGCGAGGC − 3’
rat-Caspase-35′-GTCTGACTGGAAAGCCGAAACTCT-3’5′- GAGAAGGACTCAAATTCCGTGGC-3’
Oprd1-RNAi5′-GATCCCGGCCACCAACATCTACATCTTCTCGAGAAGATGTAGATGTTGGTGGCCTTTTTGGAT-3’5′-AGCTATCCAAAAAGGCCACCAACATCTACATCTTCTCGAGAAGATGTAGATGTTGGTGGCCGG-3’
  1. has-: the primer sequences of human; rat-: the primer sequences of rat