Skip to main content

Table 1 Sequences of primers in RT-qPCR

From: Transcriptomic analysis of long noncoding RNAs and mRNAs expression profiles in the spinal cord of bone cancer pain rats

Gene namePrimer sequences (5′-3′)
CybbForward: ACCCAGATGCAAGAAAGAAACAA
Reverse: GCAAAGTGATTGGCCTGAGATT
CD74Forward: CATCTAAGGGACCCCCATTTC
Reverse: CCTAGATCTCAGAGCCCCACAT
Trpm2Forward: GAACCAGGGTGGAGGCATCT
Reverse: TGACCAGCACCTCCAACATC
CiitaForward: TGAGCACCAGACAGTGGAGTGT
Reverse: GAGATGCTCCCAGGATGCA
Anxa3Forward: CCATGGGAGGGAGAGACAGA
Reverse: CTGAAGTATCCTCTCCTCCTTTGTG
NONRATT003582.2Forward: AAATTCTTTAGCTCAGCCCTGCTA
Reverse: AATGCACGGATCCCATCTTAA
NONRATT004661.2Forward: GTATTGCGAACAAAGTCCATCCT
Reverse: GCATCCGCGAGCATGTG
NONRATT007487.2Forward: AGCCAGTGGGTCACTTGTGTT
Reverse: TTCTGCTAAAGTCCGGCTGAA
NONRATT026544.2Forward: CCCTCGTCCCTCTGGTCTATG
Reverse: GGCTTGCTCAGGGATGCA
NONRATT008764.2Forward: GAAGAGTGGGCCGAGAACAA
Reverse: AGGCAGACATCAGACACTGC
Crlf1Forward: TGCCGGCTAAACTCTGAGGAT
Reverse: GTGAGCCTCCAGGTCTGCAT
Cdc42ep2Forward: CCCGCCTCCTCTCCAACTAC
Reverse: GACCGGTGGGAAGCATACC
Hspa1bForward: TGCATGTTCTTTGCGTTTAATCTAA
Reverse: AGGTGTTCGCAGGAAGGAAA
AABR07031184.1Forward: TGTCCTTTCACGTGCTTGCT
Reverse: AGGTGAAAGGCTAAGGCAGACTT
Tnnc2Forward: CGCATTGACTTCGACGAGTTT
Reverse: GAACACGAAGACCAGCTCCTTAC
MSTRG.12616.2Forward: TTCCCAGGCAGCTTCAGACT
Reverse: AGCGGGTTGGGTCATCAG
MSTRG.13351.2Forward: CACATTGTATATCTGCGCCACAT
Reverse: TCAGCCTAGATGCCCAAGAAC
MSTRG.16194.3Forward: CCAGTGTCAAATGCATGCTCAT
Reverse: CCTGGTCTCTCCCGCTAGAA
MSTRG.16806.2Forward: GAAGCGCTTAAGCAAAGTCTCTTC
Reverse: CGATACTTTCACCAAACTCTTCCTT
MSTRG.29385.15Forward: TCCACTGGCTCAATCATGTGA
Reverse: TCCCCAGAAACAGGGATCAA
GapdhForward: TGGCCTCCAAGGAGTAAGAAAC
Reverse: GGCCTCTCTCTTGCTCTCAGTATC