Skip to main content

Table 1 Primers used for real-time PCR

From: PDK1 regulates the survival of the developing cortical interneurons

Gene Forward Reverse Tm(°C)
Gapdh ACCACAGTCCATGCCATCAT GTCCACCACCCTGTTGCTGTA 62
Pdk1 AACTGGCCACTTCCAGAGAA AAAGAAGGGGTGATCCAGGC 62