Skip to main content

Table 3 Primers used to synthesize the probes used for in situ hybridization

From: PDK1 regulates the survival of the developing cortical interneurons

Gene Forward Reverse L (bp)
Sst CCGGAATTCACGCTACCGAAGCCGTC ACGCGTCGACGGGGCCAGGAGTTAAGGA 500
Pv GGACATCAAGAAGGCGATAGG TCATCCGAGGGCCATAGAG 450
CycinD2 CCGGAATTCGGACCGTTTCTTGGCTGGAG ACGCGTCGACGCTCTGTCAGGGCATCACAC 440