Skip to main content

Table 2 Primers for real-time qPCR

From: Yin Yang 1 is critical for mid-hindbrain neuroepithelium development and involved in cerebellar agenesis

target gene name primer sequence
╬▓Actin-qPCR F ACGCGCAGCCACTGT
R CTGACCCATTCCCACCATCA
bax-qPCR F TGCTAGCAAACTGGTGCTCA
R GCCTTCCCAGCCACCCT
Bcl2-qPCR F CAACATCGCCCTGTGGATGA
R AGGGTCTTCAGAGACAGCCA
Ccna1-qPCR F CTGACCGTTCCAACCACCAA
R TGCAGCAACCAAGGAAGGAA
Ccna2-qPCR F TTACCCGGAGCAAGAAAACC
R ACGTTCACTGGCTTGTCTTCTAA
Ccnb1-qPCR F AGTGACGTAGACGCAGATGAT
R GGTCTCCTGAAGCAGCCTAAA
Ccnd1-qPCR F GCGTACCCTGACACCAATCTC
R CTCCTCTTCGCACTTCTGCTC
Ccnd2-qPCR F GTACCCGCCGTCGATGATT
R CAGCAGCAGAGCTTCGATTT
Ccne1-qPCR F AGCACTTTCTGCAGCGTCAT
R TCAAAGAAGTCCTGTGCCAAGT
cdc6-qPCR F TCAGTCCCCGAAAACGTCTG
R TTCCACGTATGTGAGCGAGG
cdk1-qPCR F TGCAGGACTCCAGGCTGTAT
R AGGCCGAAATCAGCCAGTTT
cdk2-qPCR F GAGTCCCTGTCCGAACTTACA
R TCCTTGTGATGCAGCCACTTCTA
cdk4-qPCR F ATGTGGAGCGTTGGCTGTAT
R GGGCTCGGAAGGCAGAGATT
cdk6-qPCR F GCGTACCCACAGAAACCATAAAG
R CCGAGGTAAGGGCCATCTGAAA
cdkn1a-qPCR F CCTGGTGATGTCCGACCTG
R CCATGAGCGCATCGCAATC
Cend1-qPCR F CTCCTGAGCACTCCTCGGTAT
R GGTTTGGGGCTTGTGTGACT
Gbx2-qPCR F AGACGGCAAAGCCTTCTTG
R TCGGGTCATCTTCCACCTTT
Mdm2-qPCR F CCAGGCCAATGTGCAATACCAACA
R TGCGCTCCAACGGACTTTAACAAC
Otx2-qPCR F ATCTCCCTGAGAGCGGAACC
R CAGGGTCCTTGGTGGGTAGA
Pax5-qPCR F ATTACCCGACTCCTCGGACCAT
R TGATGGGCAAGTTCCACTATCC
Trp53-qPCR F ATCCTGGCTGTAGGTAGCGA
R ATCCGACTGTGACTCCTCCA
Wnt1-qPCR F GGTTTCTACTACGTTGCTACTGG
R GGAATCCGTCAACAGGTTCGT
Wnt3a-qPCR F CTCCTCTCGGATACCTCTTAGTG
R GCATGATCTCCACGTAGTTCCTG
Wnt5a-qPCR F CAACTGGCAGGACTTTCTCAA
R CATCTCCGATGCCGGAACT
Yy1-qPCR F GCAGAGTGTGGCAAAGCGTT
R CTGAGCAAACTTCTTATTACAACCG
Yy2-qPCR F TTGATGCCTGCAACAAGAAGT
R AGGCTTCAAAGGGACTCTCACT
Wnt1pro-bs2 F CGGAGTCGCTGGCTAGAAC
R GCTGTCCTCTCGAAGTCCGT
Wnt1pro-bs3 F TAGCCCACAGAGGCAAACTG
R CACTTCCCTCACCCAGGAAC
Wnt1pro-NC1 F CCTCCCTTCCTTGTCCAACC
R CAATGCCTTTCGGGTCCTCT
Wnt1pro-NC2 F TTCACTCCTGGGACCTCGAT
R GAGGAGGCTTTGGGAGACAC