Skip to main content

Table 2 Primers and PCR conditions for BDNF 5′UTR cloning

From: Distinct role of 5′UTR sequences in dendritic trafficking of BDNF mRNA: additional mechanisms for the BDNF splice variants spatial code

  Primer forward Primer reverse PCR conditions
Exon I AATTCTCGAGTAAAGCGGTAGCCGGCTGGTGCAGG GTCTACCGGITTTGCTGTCCTGGAGACTCAGTGTC Denaturation 98 °C 10 s 31 cycles
Annealing 57 °C 20 s
Extension 72 °C 40 s
Exon IIa GATCCTCGAGGCTTTGGGAAAGCCATCCGCACGTGAC GCCACCGGTCTGGATGAAGTACTACCACCTCGGAC Denaturation 98 °C 10 s 31 cycles
Annealing 58 °C 20 s
Extension 72 °C 35 s
Exon llb GATCCTCGAGGCTTTGGCAAAGCCATCCGCACGTGAC GTTACCGOTOCAGCTTGCCAAGAGTCTATTCCAG Denaturation 98 °C 10 s 31 cycles
Annealing 58 °C 20 s
Extension 72 °C 35 s
Exon llc GATCCTCGAGGCTTTGGCAAAGCCATCCGCACGTGAC GA/\ACCGGTCTTCTTTGCGGCTTACACCACCCCGGTGGCTAG Denaturation 98 °C 10 s 31 cycles
Annealing 58 °C 20 s
Extension 72 °C 35 s
Exon III AGGCTCGAGGCCCTCACGATTCTCGCTGGATAG GCTAACCGGTCTGGGCTCAATGAAGCATCCAGCCC Denaturation 98 °C 15 s 31 cycles
Annealing 55 °C 15 s
Extension 68 °C 20 s
Exon IV AAITCTCGAGACCCACTTTCCCATTCACCGAGG GACTACCGGTCAGTCACTACTTGTCAAAGTAAACATCAAGGC Denaturation 98 °C 10 s 31 cycles
Annealing 58 °C 20 s
Extension 72 °C 20 s
Exon V GACTCTCGAGAAACCATAACCCCGCACACTCTGTGTAGTTTCATTGTGTGTTCG GACTACCGGTCTTCCCGCACCTTCCCGCACCACAGAGCTAGAAAAAGCGAACACAC Denaturation 98 °C 10 s 31 cycles
Annealing 58 °C 20 s
Extension 72 °C 15 s
Exon VI GACTCTCGAGCCAATCGAAGCTCAACCGAAGAGC GATCACCGGTCTCAGGGTCCACACAAAGCTCTCGG Denaturation 98 °C 10 s 31 cycles
Annealing 57.5 °C 20 s
Extension 72 °C 15 s
Exon VII GACTCTCGAGCACTGTCACCTGCTTTCTAGGGAGTATTACC GTACACCGGTCTCCCGGATGAAAGTCAAAACTTTCACTTCCTCTGGAGG Denaturation 98 °C 10 s 31 cycles
Annealing 58 °C 20 s
Extension 72 °C 20 s
Exon VIII GTCACTCGAGGTTATAGAGTTGGATGCAAGCGTAACCCG GCATACCGGTGACACCATTTCAGCAATCGTTTGTTCAGCTCC Denaturation 98 °C 10 s 31 cycles
Annealing 58 °C 20 s
Extension 72 °C 35 s
\