Skip to main content

Table 1 Primer sequences used for real-time PCR analysis

From: Developmental up-regulation of NMDA receptors in the prefrontal cortex and hippocampus of mGlu5 receptor knock-out mice

Name Primer Seq 5′– > 3′
Gad1 (GAD67) Forw GTACTCCTGTGACAGAGCCG
Rev GTATTAGGATCCGCTCCCGC
Gad2 (GAD65) Forw GAGCTGCAGCCTTAGGGATT
Rev GCACTCACCAGGAAAGGAAC
Grin1 (GluN1) Forw AACCTGCAGCAGTACCATCC
Rev GCAGCAGGACTCATCAGTGT
Grin2A(GluN2A) Forw TCTCCGCCTTTCCGATTTGG
Rev TGGCAAAGATGTACCCGCTC
Grin2B (GluN2B) Forw CGCTCTCCACACCCTGAGAT
Rev TAGAAGCCAAAGCTCTAGGC
Grin2C (GluN2C) Forw CATTAGGGATTTCCCCAAACGC
Rev ACCTTCCTAGTCCAAGCACA
Grin2D (GluN2D) Forw TCCTGGGGGACGATGAGATT
Rev AGTCGCCAGTACACAAGGTG
Pvalb (parvalbumin) Forw GCTTCTCCTCAGATGCCAGA
Rev CCACTTAGCTTTCAGCCACC
Reln (reelin) Forw CTCGACAAGCATCCAGTCTTC
Rev AGGTTGGTTGTAGGCAGGTG
Sst (somatostatin) Forw CCCAGACTCCGTCAGTTTCT
Rev CCAGGGCATCATTCTCTGTC
Tfrc (transferrin receptor) Forw CCAGTGTGGGAACAGGTCTT
Rev GCACCAACAGCTCCAAAGTC
Vip (vasoactive intestinal peptide) Forw GGAGCAGTGAGGGAGATTCTG
Rev CGTGGTTGTTTTCCTTCGAG