Skip to main content

Table 1 Primers for qPCR

From: Ablation of interleukin-19 improves motor function in a mouse model of amyotrophic lateral sclerosis

Gene Primer sequence
mouse Il19 sense TACAGAGACAGGGTGTTCCAGGAC
mouse Il19 antisense GCATTGGTGGCTTCCTGACTGCAGT
mouse Il6 sense ACAAGTCGGAGGCTTAATTACACAT
mouse Il6 antisense AATCAGAATTGCCATTGCACAA
mouse Il10 sense ACAAGTCGGAGGCTTAATTACACAT
mouse Il10 antisense AATCAGAATTGCCATTGCACAA
mouse Nos2 sense CAGCTGGGCTGTACAAACCTT
mouse Nos2 antisense GGGATCTGAATGTGATGTTTGGCT
mouse Il1b sense GAAATGCCACCTTTTGACAGTG
mouse Il1b antisense TGGATGCTCTCATCAGGACAG
mouse Tnfa sense GACCCTCACACTCAGATCATCTTCT
mouse Tnfa antisense CCACTTGGTGGTTTGCTACGA
mouse Tgfb1 sense CGAAGCGGACTACTATGCTAAAGA
mouse Tgfb1 antisense GTTTTCTCATAGATGGCGTTGTTG
mouse Gdnf sense CGGACGGGATAAGATGA
mouse Gdnf antisense CTGCCGCTTGTTTATCTGGT
mouse Bdnf sense GATGCCGCAAACATGTCTATGA
mouse Bdnf antisense TAATACTGTCACACACGCTCAGCTC
mouse Il20ra sense GGAAACTCAAGTCAGCCCAC
mouse Il20ra antisense AGATGGACTTCTCGCCAGTT
mouse Il20rb sense CCGAAATGCAACTGTCCTCAC
mouse Il20rb antisense AATAACCAGATGCAGCCCATGT
mouse Hprt1 sense TCAGTCAACGGGGGACATAAA
mouse Hprt1 antisense CTGGTTAAGCAGTACAGCCCC