Skip to main content

Advertisement

Table 2 Primer pairs of AVP and V1b receptor genes

From: AVP modulation of the vestibular nucleus via V1b receptors potentially contributes to the development of motion sickness in rat

Primer Sequence Product size (bp)
AVP-F1 GTCCTTCACGTTGTTTTTGCCTTA 560
AVP-R1 GTACAGCTGGCTGGGACACAA
AVP-F2 TCTCTGAAGGAAGGGCTGTGT 444
AVP-R2 TCCTTCCCCGCAGTGTCTC
AVP-F3 TCTCCAAAGGAACTCAGCAAA 350
AVP-R3 CTGGGTAGATGGTACGAAACTGTT
AVP-F4 ACTCTTGATCTTTCTATCTCCACCT 377
AVP-R4 TCCCTACACATGAGCTGTCTCTTAT
AVP-F5 GCTTCGTGTTAGTAATGTCCTTGTT 432
AVP-R5 GGCAGAGGTAGTGAGTTTGAGTTT
AVPr1b-1-F GCACAGAGACTGAAAGTAATTGGCT 428
AVPr1b-1-R CTGTCTGAAAGGCGGCGG
AVPr1b-2-F CTCAGCCCCTCCCCTCAGTA 621
AVPr1b-2-R ATGAGAGAGAAAGGTTTAGAGGTGG
AVPr1b-3-F GGCAGCCCAGCCAGTCTAC 472
AVPr1b-3-R CCACATCTGGACACTGAAGAAAGG
AVPr1b-4-F AGGGCCTTGCGCTTCCTAG 266
AVPr1b-4-R ATTCATTCAACATAGCCTTAGTGGG
AVPr1b-5-F AGGTATACAATGTTCTGCCTGCC 418
AVPr1b-5-R AAGGGAAGGGCACCCAGAG
AVPr1b-6-F TCTACAAAGAGAGAGGCTTTCCC 335
AVPr1b-6-R GCCTTGGCTAACATCCTTAATAG
AVPr1b-7-F CTCGGTGAGAGCGAAGAATTTC 363
AVPr1b-7-R GGTTCTCAACCTTAGTGCCACG
AVPr1b-8-F GTTGAGGGTCACCACAACACG 431
AVPr1b-8-R TCAGGCCCAAAGCAAGAGATC
AVPr1b-9-F GATGGACATGAACCTCTGACCTC 697
AVPr1b-9-R TGCTGAGTTTCTAAAAAGCGAAG
AVPr1b-10-F ATGACCTGACACAACGTGGAAG 454
AVPr1b-10-R TGGAGATAATTAAGAGCCATCGC
AVPr1b-11-F CAATCGTGGTGCCCCAAAC 296
AVPr1b-11-R ATGGTTGTGAGCCACCATGTG
AVPr1b-12-F CCAAATGGACACAACCAGAGAAG 652
AVPr1b-12-R GGAATAGTTTGCTTCAAGCTCAGG
AVPr1b-13-F CTGCAACCCCTGGATCTACATG 400
AVPr1b-13-R CATTCTGGCCTCTTCACCCTG