Skip to main content

Table 1 Primers used for qPCR

From: Neuronal scaffolding protein spinophilin is integral for cocaine-induced behavioral sensitization and ERK1/2 activation

Gene NCBI Refseq Sequence (5′- 3′) Amplicon lenght (bp)
D1R NM_010076.3 F: CCAAGAACGTGAGGGCTAAG
R: TGAGGATGCGAAAGGAGAAG
120
D2R NM_010077.2 F: CCACTCAAGGGCAACTGTACC
R: TGACAGCATCTCCATTTCCAG
143
mGluR5 NM_001143834.1 F: AGTCATTTACCTAAAGCCCGG
R: CTTCTCGCTGATACCCATCTG
166
NR2A NM_008170.2 F: ATGACTATTCTCCGCCTTTCC
R: AGTTTACAGCCTTCATCCCTC
220
NR2B NM_008171.3 F: GAACGAGACTGACCCAAAGAG
R: CAGAAGCTTGCTGTTCAATGG
248
DeltaFosB NM_001347586.1 F: TGCAGCTAAGTGCAGGAACCGT
R: GAGGACTTGAACTTCACTCGGCCA
224
GAPDH NM_001289726.1 F: CCTCGTCCCGTAGACAAAATG
R: TTGACTGTGCCGTTGAATTTG
194