Skip to main content

Table 1 Primers and expected products

From: Cacna1b alternative splicing impacts excitatory neurotransmission and is linked to behavioral responses to aversive stimuli

Mouse line Primers Expected products
CCK-Cre F-WT1: GGGAGGCAGATAGGATCACA
F-MT1: TGGTTTGTCCAAACTCATCAA
R: GAGGGGTCGTATGTGTGGTT
Hom: 180 bp
Het: 180 bp and 468 bp
WT: 468 bp
Dlx5/6-Flpe F-T1: CAGAATTGATCCTGGGGAGCTACG
R-T1: CCAGGACCTTAGGTGGTGTTTTAC
F-C: CAAATGTTGCTTGTCTGGTG
R-C: GTCAGTCGAGTGCACAGT TT
Transgene: 406 bp
PCR positive control: 200 bp
*PCR conditions do not differentiate between heterozygous and homozygous mice
Ai14 and RCFL-tdT F-WT2: AAGGGAGCTGCAGTGGAG TA
R-WT2: CCGAAAATCTGTGGGAAG TC
R-MT1: GGCATTAAAGCAGCGTAT CC
F-MT2: CTGTTCCTGTACGGCATGG
Hom: 196
Het: 196 and 297
WT: 297
CaMKIIα-Cre F-T1: GTT CTC CGT TTG CAC TCA GG
R-T1: CAG GTT CTT GCG AAC CTC AT
F-C: AGT GGC CTC TTC CAG AAA TG
R-C: TGC GAC TGT GTC TGA TTT CC
Transgene: ~  500 bp
PCR positive control: 521 bp
  1. All primers are reported in 5′ to 3′ direction