Skip to main content

Table 1 List of primers for quantitative RT-PCR

From: Identification of a novel Shank2 transcriptional variant in Shank2 knockout mouse model of autism spectrum disorder

NameSequence
ex2fCTTCACTCAACAGGCTGGGTG
ex4fTGGTTCCCAGCTGAGTGTGTG
ex4’fCGGTCTGAGTGAGATGGTCA
ex4rCTCTCCGATGCTCAGAACTTTGAC
ex5rTAGGAGCCCACCGTGTAATG
ex6rCCAAAGCCCTCGTTGTCCTTC
Actb forwardCTTCTCCAGGGAGGAAGAGG
Actb reverseAGCCATGTACGTAGCCATCC