Skip to main content

Table 2 List of RT-qPCR primers

From: Atg7 deficiency in microglia drives an altered transcriptomic profile associated with an impaired neuroinflammatory response

Genes Forward primer Reverse primer
RT-qPCR primers
 Actb GATGTATGAAGGCTTTGGTC TGTGCACTTTTATTGGTCTC
 Apoe ACCTGATGGAGAAGATACAG GATATGGATGTTGTTGCAGG
 Arg1 GGAGACCACAGTCTGGCAGTTGGA GGACACAGGTTGCCCATGC
 Atg7 CTGTTCACCCAAAGTTCTTG TCTAAGAAGGAATGTGAGGAG
 Nfkb1 AGGACATGGGATTTCAGGA GGAGGTGGATGATGGCTAA
 Nfkb2 TCAAGATCTGTAACTATGAGGG TTCTTCTTGGTTACATGCAG
 Nos2 GCGGAGTGACGGCAAACAT AGGTCGATGCACAACTGGG
 Rel ATACCTGCCAGATGAAAAAG TCAGTAAAGTGACCACAATC
 Rela GCTCCTAAGGTGCTGACA ACCTCCGAAAGCGAGATA
 Relb CGGATTTGCCGAATCAAC CGGATATGTCCTCTTTTTGC
  1. List of primer sequences used in this study. All the sequences are given 5ʹ to 3ʹ