Skip to main content

Table 1 Primers for single-cell real-time PCR

From: Profile of dorsal root ganglion neurons: study of oxytocin expression

   Primer sequence (5′–3′) Accession number
OXT Forward TTGGCTTACTGGCTCTGACCTC NM_011025
  Reverse GGGAGACACTTGCGCATATCCAG  
OXTR Forward TTCTTCGTGCAGATGTGGAG NM_001081147
  Reverse CCTTCAGGTACCGAGCAGAG  
V1aR Forward TGTGGTCAGTCTGGGATACC NM_016847
  Reverse GGGAAGCTCTGGACACAATC  
TRPV1 Forward ATCATCAACGAGGACCCAGG NM_001001445
  Reverse TGCTATGCCTATCTCGAGTGC  
Piezo2 Forward TCAGAACCAACCAAAGCAACG NM_001039485
  Reverse TTGTAAGCAGGTGTGATGCGG  
GAPDH Forward TATGACTCCACTCACGGCAAAT NM_001289726
  Reverse GGGTCTCGCTCCTGGAAGAT  
β-actin Forward GACTCATCGTACTCCTGCTTG NM_007393
  Reverse GATTACTGCTCTGGCTCCTAG