Skip to main content

Advertisement

Table 1 Small interfering RNA sequences

From: TRPC1 mediates slow excitatory synaptic transmission in hippocampal oriens/alveus interneurons

TargetSense (5′ to 3′)Antisense (5′ to 3′)
TRPC1GAACAUAAAUUGCGUAGAUUUPAUCUACGCAAUUUAUGUUCUU
GGACUACGGUUGUCAGAAAUUPUUUCUGACAACCGUAGUCCUU
GAAUUUAAGUCGUCUGAAAUUPUUUCAGACGACUUAAAUUCUU
UGAACUUAGUGCUGACUUAUUPUAAGUCAGCACUAAGUUCAUU
TRPC4GCCAUUAAGUACCGUCAAAUUPUUUGACGGUACUUAAUGGCUU